Palindromic Sequences Finder

AACAATGCCATGATGATGATTATTACGACACAACAACACCGCGCTTGACGGCGGCGGATGGATGCCG CGATCAGACGTTCAACGCCCACGTAACGTAACGCAACGTAACCTAACGACACTGTTAACGGTACGAT
Minimum length of palindromic sequence: 4 5 6 7 8 9 10
Maximum length of palindromic sequence: 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

 

---

Definitions
Palindromic sequence:
A DNA sequence whose 5'-to-3' sequence is identical on each DNA strand. The sequence is the same when one strand is read left to right and the other strand is read right to left. Recognition sites of many restriction enzymes are palindromic.

---